[BioC] FrozenRMA how to

Matthew McCall mccallm at gmail.com
Sun Mar 4 05:44:05 CET 2012


Alex,

What you propose is technically correct. A few words of caution:

1. The barcode distributions were estimated based on arrays
preprocessed with the default frma summarization (not random_effect
summarization). While the default summarization does not attempt to
estimate and correct for a batch-specific probe effect in your data,
it does down-weight probes that are "batchy". Most of the time, the
two methods yield very similar results.

2. The barcode function is designed to be fairly conservative in
calling genes expressed, so I imagine you will get a very large number
of unexpressed genes. You can easily change this behavior by altering
the threshold in the barcode function, or perhaps even better, have
the barcode function return a z-score, which you can use to determine
expressed / unexpressed.

Best,
Matt

2012/3/3 Alejandro Sánchez Pla <sanplaale at gmail.com>:
> Hello
> I have a doubt about how to use frma.
> I have 30 hgu133plus2 arrays where I would like to find the
> "unexpressed" genes. If I have understood it well the "barcode"
> function in the frma package can be used to find such genes, or, say
> provide a proposal.
> The arrays have been obtained in two different batches so frma seems
> even more approprite because ir claims to have the ability to process
> data from different batches.
> My question is then how should I proceed.
> My idea is
> - Process every batch (two in this case)  separately
> - Combine the data inti a single object
> - Use barcode on this object to call the unexpressed genes.
>
> Can someone confurm me If this is the right approach?
>
> thanks for the help
>
> Alex Sanchez
> Statistics Department. Universitar de Barcelona &
> Statistics and Bioinformatics Unit. Vall d'Hebron Research Institute
>
>
>
> Enviado desde mi iPhone
>
> El 03/03/2012, a las 12:00, <bioconductor-request at r-project.org> escribió:
>
>> Send Bioconductor mailing list submissions to
>>    bioconductor at r-project.org
>>
>> To subscribe or unsubscribe via the World Wide Web, visit
>>    https://stat.ethz.ch/mailman/listinfo/bioconductor
>> or, via email, send a message with subject or body 'help' to
>>    bioconductor-request at r-project.org
>>
>> You can reach the person managing the list at
>>    bioconductor-owner at r-project.org
>>
>> When replying, please edit your Subject line so it is more specific
>> than "Re: Contents of Bioconductor digest..."
>>
>>
>> Today's Topics:
>>
>>   1. Provide an Example for AnnotatedDataFrame (Deepak Datta)
>>   2. Re: Difficulty in AnnotatedDataFrame (James F. Reid)
>>   3. Re: easyRNASeq error (Nicolas Delhomme)
>>   4. Biobase typo in example of AnnotatedDataFrame man page
>>      (James F. Reid)
>>   5. Re: Biobase typo in example of AnnotatedDataFrame man page
>>      (Martin Morgan)
>>   6. Re: easyRNASeq error (Nicolas Delhomme)
>>   7. Re: A problem about trimLRPatterns (wang peter)
>>   8.  Summarizing Single-channel Agilent data (David Westergaard)
>>   9. Gene-Metabolite correlation network (pankaj borah)
>>  10. Re: problem creating own org.Ss.eg.db (Hooiveld, Guido)
>>  11. Re: Summarizing Single-channel Agilent data
>>      (axel.klenk at actelion.com)
>>  12. Re: Gene-Metabolite correlation network (Sean Davis)
>>  13. Re: Gene-Metabolite correlation network (pankaj borah)
>>  14. Re: A problem about trimLRPatterns (Harris A. Jaffee)
>>  15. KEGGSOAP (Ricardo Silva)
>>  16.  GAGE heatmap pdf question... (Alan Derr)
>>  17. Re: Finding coding SNPs with predictCoding (Valerie Obenchain)
>>  18. Re: Finding coding SNPs with predictCoding (Thomas Girke)
>>  19. Re: KEGGSOAP (Martin Morgan)
>>  20. unable to readImage using EBImage package (diyanah [guest])
>>  21. Re: unable to readImage using EBImage package (Dan Tenenbaum)
>>  22. beadarray vignette has broken code in R2.14.1? (Henriquez, Nick)
>>  23. Re: Gene-Metabolite correlation network (B Usadel)
>>  24. Re: Gene-Metabolite correlation network (B Usadel)
>>  25. Warning of function "ncbiTaxonomy" (???)
>>  26. Re: how edgeR control outliers? (Yuan Tian)
>>  27. Re: beadarray vignette has broken code in R2.14.1? (Dan Tenenbaum)
>>
>>
>> ----------------------------------------------------------------------
>>
>> Message: 1
>> Date: Fri, 2 Mar 2012 16:29:54 +0530
>> From: Deepak Datta <deepaktheinvincible at gmail.com>
>> To: bioconductor at r-project.org
>> Subject: [BioC] Provide an Example for AnnotatedDataFrame
>> Message-ID:
>>    <CAHzX1SmQ_WUjujhithkt8FHN9cQ1wvFDJCuyFy9h9uYY4=sHRA at mail.gmail.com>
>> Content-Type: text/plain
>>
>> hii... this is Deepak....
>>
>> i am working on analysis of microarray data using bioconductor and i am
>> rank amateur in R
>>
>> I tried using this code snippet
>> phenoData(spikein95) <- new("phenoData", pData = pd, varLabels = vl)
>>
>> but it said that phenoData is now defunct and we need to use
>> AnnotatedDataFrame. And i am not able to proceed because of the following
>> error
>>
>> AnnotatedDataFrame(x1)<-new("AnnotatedDataFrame",pData=pd, varLabels=v1)
>> Error in .nextMethod(.Object, ...) :
>>  invalid names for slots of class ?AnnotatedDataFrame?: pData, varLabels
>>
>>
>> i am basically trying to segregate the samples into 3 parts containing
>> normal, HSIL and SCC data and this is the code that i have used till now...
>>
>> setwd("E:\\Project\\CEL files\\Old\\GSE7803-3")
>>> f1=list.celfiles(path="E:\\Project\\CEL files\\Old\\GSE7803-3")
>>> x1<-ReadAffy(filenames=f1)
>>> pd <- data.frame(population = c(1,1,1,1,1,1,1,1,1,1,2, 2,
>> +  2,2,2,2,2,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3,3),
>> +  replicate= c(1,2,3,4,5,6,7,8,9,10,1,2,3,4,5,6,7,
>> +  1,2,3,4,5,6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21))
>>> rownames(pd) <- sampleNames(x1)
>>> v1 <- list(population = "1 is normal, 2 is HSIL, 3 is SCC",
>> replicate="arbitary numbering")
>>
>>
>> i further wish to perform rma and then generate a MA plot.
>>
>> kindly help me rectify this error and please explain with an *example* so
>> that i could proceed further.
>>
>>    [[alternative HTML version deleted]]
>>
>>
>>
>> ------------------------------
>>
>> Message: 2
>> Date: Fri, 02 Mar 2012 11:03:37 +0000
>> From: "James F. Reid" <james.reid at ifom-ieo-campus.it>
>> To: Deepak Datta <deepaktheinvincible at gmail.com>
>> Cc: bioconductor at r-project.org
>> Subject: Re: [BioC] Difficulty in AnnotatedDataFrame
>> Message-ID: <4F50A909.1020602 at ifom-ieo-campus.it>
>> Content-Type: text/plain; charset=windows-1252; format=flowed
>>
>> Hi Deepak,
>>
>> please keep the thread on the list for other users.
>>
>> On 02/03/12 10:28, Deepak Datta wrote:
>>> hey James, i have read the help page and i did not find it helpful. i
>>> would really appreciate if you could please explain me with an example
>>> giving details on creating a metaData
>>
>>
>> something like this should work:
>>
>> new("AnnotatedDataFrame",
>>     data=pd,
>>     varMetadata=data.frame(labelDescription=unlist(v1)))
>>
>> since your v1 is a list (it needen't be).
>>
>> Best.
>> J.
>>
>>>
>>>
>>> On Fri, Mar 2, 2012 at 3:49 PM, James F. Reid
>>> <james.reid at ifom-ieo-campus.it <mailto:james.reid at ifom-ieo-campus.it>>
>>> wrote:
>>>
>>>    Hi Deepak,
>>>
>>>    you need to construct an AnnotatedDataFrame in the following way:
>>>    AnnotatedDataFrame(data=df, varMetaData=metaData)
>>>    Look-up the help page which is well documented:
>>>    help("AnnotatedDataFrame")
>>>
>>>    HTH.
>>>    J.
>>>
>>>
>>>    On 02/03/12 10:11, Deepak Datta wrote:
>>>
>>>        hii... this is Deepak....
>>>
>>>        i am working on analysis of microarray data.
>>>
>>>        We tried using this code snippet
>>>        phenoData(spikein95)<- new("phenoData", pData = pd, varLabels = vl)
>>>
>>>        but it said that phenoData is now defunct and we need to use
>>>        AnnotatedDataFrame. And i am not able to proceed because of the
>>>        following
>>>        error
>>>
>>>        AnnotatedDataFrame(x1)<-new("__AnnotatedDataFrame",pData=pd,
>>>        varLabels=v1)
>>>        Error in .nextMethod(.Object, ...) :
>>>           invalid names for slots of class ?AnnotatedDataFrame?: pData,
>>>        varLabels
>>>
>>>
>>>        i am basically trying to segregate the samples into 3 parts
>>>        containing
>>>        normal, HSIL and SCC data and this is the code that i have used
>>>        till now...
>>>
>>>        setwd("E:\\Project\\CEL files\\Old\\GSE7803-3")
>>>
>>>            f1=list.celfiles(path="E:\\__Project\\CEL
>>>            files\\Old\\GSE7803-3")
>>>            x1<-ReadAffy(filenames=f1)
>>>              pd<- data.frame(population = c(1,1,1,1,1,1,1,1,1,1,2, 2,
>>>
>>>        +  2,2,2,2,2,3,3,3,3,3,3,3,3,3,3,__3,3,3,3,3,3,3,3,3,3,3),
>>>        +  replicate= c(1,2,3,4,5,6,7,8,9,10,1,2,3,__4,5,6,7,
>>>        +  1,2,3,4,5,6,7,8,9,10,11,12,13,__14,15,16,17,18,19,20,21))
>>>
>>>            rownames(pd)<- sampleNames(x1)
>>>            v1<- list(population = "1 is normal, 2 is HSIL, 3 is SCC",
>>>
>>>        replicate="arbitary numbering")
>>>
>>>
>>>        i further wish to perform rma and then generate a MA plot.
>>>
>>>        kindly help me rectify this error and if possible explain with
>>>        an example
>>>        so that i could proceed further.
>>>
>>>                [[alternative HTML version deleted]]
>>>
>>>
>>>
>>>
>>>        _________________________________________________
>>>        Bioconductor mailing list
>>>        Bioconductor at r-project.org <mailto:Bioconductor at r-project.org>
>>>        https://stat.ethz.ch/mailman/__listinfo/bioconductor
>>>        <https://stat.ethz.ch/mailman/listinfo/bioconductor>
>>>        Search the archives:
>>>        http://news.gmane.org/gmane.__science.biology.informatics.__conductor
>>>        <http://news.gmane.org/gmane.science.biology.informatics.conductor>
>>>
>>>
>>
>>
>>
>> ------------------------------
>>
>> Message: 3
>> Date: Fri, 2 Mar 2012 12:20:36 +0100
>> From: Nicolas Delhomme <delhomme at embl.de>
>> To: "Davis, Wade" <davisjwa at health.missouri.edu>
>> Cc: Bioconductor mailing list <bioconductor at r-project.org>
>> Subject: Re: [BioC] easyRNASeq error
>> Message-ID: <8395D3FF-9D14-49E1-855F-E578A39E3089 at embl.de>
>> Content-Type: text/plain; charset=us-ascii
>>
>> Hi Wade,
>>
>> I'll send you the package off-list. And discuss how we can do for the data as it's still interesting for me to enhance my chromosome name validity checks.
>>
>> Cheers,
>>
>> Nico
>>
>> ---------------------------------------------------------------
>> Nicolas Delhomme
>>
>> Genome Biology Computational Support
>>
>> European Molecular Biology Laboratory
>>
>> Tel: +49 6221 387 8310
>> Email: nicolas.delhomme at embl.de
>> Meyerhofstrasse 1 - Postfach 10.2209
>> 69102 Heidelberg, Germany
>> ---------------------------------------------------------------
>>
>>
>>
>> On 1 Mar 2012, at 23:14, Davis, Wade wrote:
>>
>>> Hi Nico,
>>> If you could send me a windows zip that I could try out the changes now instead of waiting for them to get pushed through in a few days. But I don't mind waiting, whatever is easiest for you.
>>>
>>> I've been in a workshop all days, so I haven't gotten a chance to try out the suggestions for the second problem, but I will do so and get back to do.
>>>
>>> Also, you asked for a sample file to help with the second problem. I'm not sure if you still want or need that, but below is the first 60 lines or so. I can send you an entire file (compressed which is about 455MB) if you think that would be helpful.
>>>
>>> Thanks!
>>>
>>> Wade
>>>
>>> HWI-ST538    160    7    1101    1635    1954    ACAGTG    1    GATATCTNNNNNNGAAGAAAACGAGGGAGATTCCAAGGCCGAGCAGCTACACCNGGTACAGAAGCAGTCTGCCACTTTGCCCTCGCCCATCACCCACTCC
>>> BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB    QC                                            N
>>> HWI-ST538    160    7    1101    1661    1972    ACAGTG    1    GGATAGCATNNNAAATGTAAATGAGGAAAATACCTAATAAAAAATATTAAAAAAAAAAAAGACACCGCCAGGAACTTGTGAGAAATCCAAATTCTACATT
>>> [[[______BBBQQX_^^^^_^___^]^_^^^^[^^^^^^]^^^^^^^^^^^^^^^^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB    QC                                            N
>>> HWI-ST538    160    7    1101    1949    1944    ACAGTG    1    AGGGGTTNNNNNNTTCAAGACCTCTCCCCTGNNGAGAAAGAAACCCAAGCAGNNGCCTGTGGGAGGGAACACGGACCTGACACCTCTGCCTCAGACTCCT
>>> [[XZY_^BBBBBBQQ[\Z\]_[[Z^^]^^[^BBOL[\X^^PY]ZX\^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB    QC                                            N
>>> HWI-ST538    160    7    1101    1820    1948    ACAGTG    1    GTCAGCTNNNNNNAGGGTCCGATCGTATTGGANGAGGATATCTTTGATCTCCNNCTTGGAGGCTTCATCCACATATTTTTGGTAATAAGCTACCAGGGCC
>>> [[[^___BBBBBBRS]_]^__^__^^^^^^^^BO[\^^^^^^^^^\^^^^^]BBLW\\^]_^X^^]\]]]]^^]]]]]^\[VZZ\\\\Y[\\\[\[[Y[[    QC                                            N
>>> HWI-ST538    160    7    1101    1773    1957    ACAGTG    1    CTTTGGTTNNNNNGACCTCGCTTGTAGCCAGCAAAAATGGCCTTGCACCACAGCCTTCCAGACATACTTGCTGTTAGAAGTCCTGAGATCGGAAGAGCAC
>>> WZZ_[\]_BBBBBRQY_^^\Z^__^^^^^^]^]^]^^^^^^]^^^]]X]]]^^^^^^^___[^^]]^^^]^^W\\]]]\]V\\\][[[\\[[Z[Y[[WZW    QC                                            N
>>> HWI-ST538    160    7    1101    1971    1962    ACAGTG    1    CTTTGTTTNNNNTCTGGTCACAATAGTTGGGGGCAGAAAAGACAGTGACACAGCGGCCACCATGGGCCACCTCGTAGCCCTCGGCTTTGACTTCATGGCT
>>> [[[_____BBBBRR_____^__^________^^^^^^^^^^^^^^^^^^^^^^[^^\\[[^[[[\[[[[[[[[[W[[[\\[[WY[[U[YT[[\[YZSYW[    QC                                            N
>>> HWI-ST538    160    7    1101    1878    1976    ACAGTG    1    CCGCTGTCTTNCTCAGGAAGCACGCATTTCCACAGGCCATAGGGCTTTCCTACCACAGTTTGCCACAATCTCAATGTCCCATCTTCAGAACCGCTGGCAT
>>> ^W^\cc\`^`BQQ``JY[YRb`^_dUccaSccaIYHOWOXRacQaaQabd\bbcbbcc\^bccc]Z^c_]R_````UZZ]`Y\ZT]]`BBBBBBBBBBBB    RM                                            N
>>> HWI-ST538    160    7    1101    1934    1999    ACAGTG    1    CTCCACTGAAGTACTTCAGGTAGTAGTCCATGACGCCCTTGTCGTCGGTTCGCGACTCCTCATCACTGTCCCCGGCCCGGCCCACCGATGACATCATCTG
>>> bbbeeeeegggeghiiiiiigghgfiiiiihihiihiihiihhfghdgZeefhadeecdbdb`bccbb`bb`aQX[acX[[acO[aOEHOGYRY`]Y`R]    chr10.fa        80607676    R    100    500                        Y
>>> HWI-ST538    160    7    1101    2013    1948    ACAGTG    1    CACATCTNNNNNNCCATGGAGCAGATTGAAGANGAAATCAAAGGTTGTTTGGNNTTTCTTCGCACAGTATATAGTGTCTTTGGATTTTCATTTAAATTGA
>>> [[[___^BBBBBBRSX_____^_^_^_^__^^BP[^^^^^^^^^\^^^^^^[BBLW\^^__]^^^^^Z\]]]]^\Z\]]^^][[\\\\\\\\\\\\[\Y[    QC                                            N
>>> HWI-ST538    160    7    1101    2064    1957    ACAGTG    1    AGAAAGTTNNNNNATAGAAGATGTATAAGTTGATCGTAACGGAAGCGTGGATAAGATGCTCGGATCCATAGGAATGTTGATGATAGTAGTAGAGCTTCTA
>>> [[[[^[\_BBBBBQQ\[\^]__^[_]_^^^_^^__^[^^[[W^^[^^\^^\^^^]^^^___[^[XW]Z]^^BBBBBBBBBBBBBBBBBBBBBBBBBBBBB    QC                                            N
>>> HWI-ST538    160    7    1101    2129    1991    ACAGTG    1    GTAATATTCATTTAGCCTTCTGAGCTTTCTGGGCAGACTTGGTGACTTTGCCAGCTCCAGCAGCCTTCTTGTCCACAGCTTTGATGACACCCACAGCAAC
>>> ___ce`cce`ggfdhfhfgbfbefdghggfd`ff]eZegg]eIYYYceg^cedfce^ebgfce_ccfhdfdZbdbV`db]Za^ZaZ]__bbaa_PTGT^`    RM                                            Y
>>> HWI-ST538    160    7    1101    2267    1959    ACAGTG    1    CAGCACAGNNNNGATGGCTACGTACATGGCTGGGGTGTTGAAGGTCTCAAACATGATCTGGGTCATCTTTTCACGGTTGGCCTTAGGGTTCAGGGGGGCC
>>> [[[__^^^BBBBQQ_\^[^]^^^^^[^_^[^^^^^\Z\^RU\]]UY]WXZ^]Z^]Z]^_^^]ZZV^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB    QC                                            N
>>> HWI-ST538    160    7    1101    2466    1999    ACAGTG    1    CGTACTTCTCCCACTCGCTTGTGCTCTGTCACTAGAAGGTTATTCTTGAAAGGTTCTGTGCCTTTTTCTTCAGGCTTCATCTGTCATACCTCTACTTGAT
>>> bbaeeeeegggggiiifiiiihiiiiihhhiiihighiiafgfhiiifaehghXcghhhhbghiiiifhhfdghhgfedgeddcbeeccbddd`c_b`cc    chr7.fa        54159980    R    100    504                        Y
>>> HWI-ST538    160    7    1101    2566    1981    ACAGTG    1    ATTGAACTCANCTCCTTTTAGGTTGCCCTACTAACTGGACATTGTGGACACTAAATCATATTGGGGTGATGAATAATCAAATTTTCAATATCAAACAATG
>>> abaceeeeggBQ`eghhiifhhiiigihifhihfhhihhiifhffdgffhifhihfhhhiihdgfgZd^bd^ade^abddc]`bc__bcdc_c_bb`abb    chr10.fa        66474748    R    10G89    497                        Y
>>> HWI-ST538    160    7    1101    2943    1957    ACAGTG    1    TCCGAATANNNNNCGGTCAAAATAAAAGCTCAAGATGACATCAGTCCCATTTGTCCTAAGTCCTGGTGTTGTATGGATGGTAAGCAGCAGCCAATTATGG
>>> [[[^^^^_BBBBBQQ_\_^___^_^_^^^^^^^^^^^^^^^^^^\^^^^^^^^^^^^^__\]^]^_]^^^^^_^_^^^^^W\]Z]]][[^[[[[W[\\\[    QC                                            N
>>> HWI-ST538    160    7    1101    2883    1967    ACAGTG    1    ATCAGACTCNNNCTGCACGTTCACACCATAAGTCTCATCAATGTTGTCATCCATATTCTGTATCTCCTTGTCGCCACCGTAGTCTGTGATCTTCTTGCCC
>>> [[[__^^^^BBBR[T]]^^][]]^^[X][]]W^]^^^^X[Y\[YRY^[^^^^[]^^^^]^\Y]\Z^^[[ZU\\^BBBBBBBBBBBBBBBBBBBBBBBBBB    QC                                            N
>>> HWI-ST538    160    7    1101    3133    1960    ACAGTG    1    CTCTCAAANNNNCTACAGAGCCCAGGAAGATTTCAGGATGAAGAGCTTCCTCCTCTTCCTCACTATCATTCTTCTGGTTGTGATTCAGATACAAACAGGA
>>> [[[^Z]_]BBBBSQ\_Z^_^_^^_^^^]_^^^^\^^^[Z]^^^^^^]^^^^^^]^]^^_]^ZZY^^_\]^\]^[]Z\^^Z\\]\\\\\\\]]]]\[[VQV    QC                                            N
>>> HWI-ST538    160    7    1101    3023    1964    ACAGTG    1    GGCCACTCTNNNTTGTGCCTTCCACACCTTTTGGTGCAGATTGTTCAGTGGGGAGCTGCCTCATATTCTCTGACTGGCCAGAAAGGCTCTCGCTGGGGTT
>>> [[[__^^^^BBBRQ_\_^^___^^^^_^^__^]^^^^^^^^^^^]\^^]^^^^^^^^^T]^^ZZ^\^]^^^]\\]]^BBBBBBBBBBBBBBBBBBBBBBB    QC                                            N
>>> HWI-ST538    160    7    1101    3219    1966    ACAGTG    1    CAGATGTGTNNNAATGCTAGGTGTGGTTGGTTTATTCCTAGCGTCACTATTATCAGGCCTAGTTGGCTTGATGTAGAGAAGGCAATGATTTTTTTGATGT
>>> [[[^_____BBBS[]___^__[_]_^\__^Z]^^^^^^^^^^^^^^^^^^^^^^]^^^^_[^^^^___^[^^]]]\\]\]]^^[[\\\\\\\\YXTW[\\    QC                                            N
>>> HWI-ST538    160    7    1101    3047    1993    ACAGTG    1    CTCTTGTGTCCGTTTTCTTGCTGTAGCGTTTTCTCCGTACCACTCACTGATACCTGTCTATCGACTACGTGGGATGGCAGAGGCACTGCCAGGCTCCACA
>>> bbbeeedegggfghiiiihhiihifhiieggihffh[affgcgfebb]eefdfh[bgbcdfe_fW^\]aaZa`abZ^``a_GWWW^```^bS^`W^^BBB    chr1.fa        154218045    F    100    36                        Y
>>> HWI-ST538    160    7    1101    3462    1958    ACAGTG    1    CCACTCGTNNNNCTTGCGATCATTGTGCTTAGGGTCTTCTGATACATCTGGGGGAACATCTGTTTTATCTGAACAAGGTCAATCTCACTTCGAGTGACCA
>>> [[[^^^_\BBBBQQ[ZZ^_[Y_[_]_\W^^^^[^M[]]]]\]]^^^^]\^^^FZF\\]Z^^^X\^^^]]^]\Z\]ZOZXZZ[\\\\TZU\[ZTTW[\[\\    QC                                            N
>>> HWI-ST538    160    7    1101    3261    1972    ACAGTG    1    CCTGGATGTNNNCGTGGATCGGGTCTTGAACGTGGACTTGCCGCACCTTGTATCTCAAGCCCAGCGCCACACCCTTGCTGACTTTCTGAACACTACTGTC
>>> BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB    QC                                            N
>>> HWI-ST538    160    7    1101    3390    1979    ACAGTG    1    TGCAGTTCTTNCCCGTGGCTCCTGAGCCAGCAATGTCGTCTGGGAAGCCATCATCAGCTCATTCAGCTGAGACGTGCTAGAGGTCTCCTCAGCTTGGAGC
>>> bbbeeeeeggBRbfgfhihiiihhhhiiiiiehhichhgggfghbgedgdffhffdefff`bd]bdfedceecdZZ`_`bb_aL[bcc`b]`b]`b_`[`    chr1.fa        187111962    F    10T89    497                        Y
>>> HWI-ST538    160    7    1101    3666    1959    ACAGTG    1    CCGAACACNNNNCCCGGATCTCATCTCACAGAATCGTGGGTACGTCTGAACCAGCTGGTTGCCCCCAAAAATTACCTGTTTCACGCCCCTGGTGCAGCCC
>>> BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB    QC                                            N
>>> HWI-ST538    160    7    1101    3667    1975    ACAGTG    1    AGAACACCGANGTCCACCTTCAAGTTAGGGGAAATGGCATATTCTTCGATCGGCTTGCTGATTTGGGAAATTTTATCCTTGACTGCTTCTGGAGCAGGAC
>>> PZZTTP_BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB    chr4.fa        99634649    R    10G3T10C4C19T1T13A10AG3T17    77                        N
>>> HWI-ST538    160    7    1101    3986    1969    ACAGTG    1    ATTAAATCTNNNCATGCTCTGAAAAAGGCTTTAGGTCACTCCAAGCTTGGCAGTTAACATTTGGCATGGACACTGGTAAAACCACAATAGAGAAAGAAGT
>>> [[[^_____BBBRY__^^^__^^^^^_^^__^^^^^^^^^]^^^^^^^]^^^^\^^^^____]^____[^^[^^^^Z^Z\\\\^[^^^]]\[\\\\[[[R    QC                                            N
>>> HWI-ST538    160    7    1101    4230    1977    ACAGTG    1    CGCCTCCGGGNCGTGGCACTCTGGGGCTCTGCCGTCGACATGGGCGCCGCC
>
> _______________________________________________
> Bioconductor mailing list
> Bioconductor at r-project.org
> https://stat.ethz.ch/mailman/listinfo/bioconductor
> Search the archives: http://news.gmane.org/gmane.science.biology.informatics.conductor



-- 
Matthew N McCall, PhD
112 Arvine Heights
Rochester, NY 14611
Cell: 202-222-5880



More information about the Bioconductor mailing list