[Bioc-sig-seq] qa error in ShortRead

[Martin Morgan]

On 09/14/2010 09:27 PM, Kunbin Qu wrote:
> Hi, 
> 
> I received the following error when I tried to read some fastq in and
> generate QA report. Could anybody help me? Thanks.
> 
> -Kunbin
> 
> 
> [srp101]more tmp2
> @SEQUENCER01_0007:1:1:1066:13331#0/1
> CAGCTANCTGCGTTCTTCATCGACGCACGAGCCGAGTATTAATGTGAATTG
> +SEQUENCER01_0007:1:1:1066:13331#0/1
> fdfffcBccccccccfffffffeffffffcfffffedcfcffffddedfdd
> @SEQUENCER01_0007:1:1:1066:8699#0/1
> CTTACCNCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCAC
> +SEQUENCER01_0007:1:1:1066:8699#0/1
> cc^ccaBV]]ba_^Zc^cbaa`c`cL^```cb\ccc^aaaaa^aabba`bb
> @SEQUENCER01_0007:1:1:1066:20185#0/1
> GCCACANACACCTGATTATCAACAGCCCGGCTTCGCTGAAGTAACTCCCAA
> +SEQUENCER01_0007:1:1:1066:20185#0/1
> fffffbBbbbcccccfffffefffffffffeffffffffefffffdefffd
> [srp101]
> 
> 
>> s6<-readFastq("./", "tmp2")
>> q6<-qa(s6)
> Error: UserArgumentMismatch
>   'lane' must be 'character(1)'

see

?"qa,ShortReadQ-method'

it wants to be able to record which lane the data comes from, so

  q6 <- qa(s6, "lane6tmp2")

or whatever is appropriate.

Martin

> 
> 
>> sessionInfo()
> R version 2.11.0 (2010-04-22) 
> x86_64-unknown-linux-gnu 
> 
> locale:
>  [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C              
>  [3] LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8    
>  [5] LC_MONETARY=C              LC_MESSAGES=en_US.UTF-8   
>  [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                 
>  [9] LC_ADDRESS=C               LC_TELEPHONE=C            
> [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C       
> 
> attached base packages:
> [1] stats     graphics  grDevices utils     datasets  methods   base
> 
> 
> other attached packages:
> [1] ShortRead_1.6.2     Rsamtools_1.0.1     lattice_0.18-8     
> [4] Biostrings_2.16.7   GenomicRanges_1.0.1 IRanges_1.6.8      
> 
> loaded via a namespace (and not attached):
> [1] Biobase_2.8.0 grid_2.11.0   hwriter_1.2  
>>
> 
> ______________________________________________________________________
> The contents of this electronic message, including any attachments, are intended only for the use of the individual or entity to which they are addressed and may contain confidential information. If you are not the intended recipient, you are hereby notified that any use, dissemination, distribution, or copying of this message or any attachment is strictly prohibited. If you have received this transmission in error, please send an e-mail to postmaster at genomichealth.com and delete this message, along with any attachments, from your computer.
> 
> _______________________________________________
> Bioc-sig-sequencing mailing list
> Bioc-sig-sequencing at r-project.org
> https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing