[Bioc-sig-seq] trimLRPatterns related error

Kunbin Qu KQu at genomichealth.com
Tue Oct 26 22:51:58 CEST 2010


Hi, all,

I am trying to use trimLRPatterns to construct a set of reads after trimming from both ends. After trimming is done to the three prime, some reads are already down to zero. Then when I tried to trim from the five prime, the trimming (trimLRPatterns) did not raise any error, however, the following DNAStringSet construction threw some errors, like the following. Could anybody help me? Thanks a lot!

-Kunbin

> #after trimming from the five prime, read No. 2 now is zero in length
> seqsART
  A DNAStringSet instance of length 7
    width seq
[1]     5 NGTCA
[2]     0 
[3]     8 NCGGTGCA
[4]    24 NGACGGTTCACCCCTCGTGGGCAA
[5]    49 TATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAAAAAAAAA
[6]    36 TATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAA
[7]    49 TATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAACCTAAACCAGGG
> trimCoordsAL<-trimLRPatterns(Lpattern=adapter, subject=seqsART, max.Lmismatch = rep(1,46), ranges=T, with.Lindels=TRUE)
> adapter<-DNAString("TTTACACGCGTCTCCCGGGCTTATCTCGTATGCCGTCTTCTGCTTG")
> trimCoordsAL
IRanges of length 7
    start end width
[1]     3   5     3
[2]     2   1     0
[3]     2   8     7
[4]     3  24    22
[5]    27  49    23
[6]    27  36    10
[7]    27  49    23
> seqsAL <- DNAStringSet(seqsART, start=start(trimCoordsAL), end=end(trimCoordsAL))
Error in solveUserSEW(width(x), start = start, end = end, width = width) : 
  solving row 2: 'allow.nonnarrowing' is FALSE and the supplied start (2) is > refwidth + 1
>

______________________________________________________________________
The contents of this electronic message, including any attachments, are intended only for the use of the individual or entity to which they are addressed and may contain confidential information. If you are not the intended recipient, you are hereby notified that any use, dissemination, distribution, or copying of this message or any attachment is strictly prohibited. If you have received this transmission in error, please send an e-mail to postmaster at genomichealth.com and delete this message, along with any attachments, from your computer.



More information about the Bioc-sig-sequencing mailing list