[Bioc-sig-seq] readAligned for Illumina's export file

Kunbin Qu KQu at genomichealth.com
Fri Nov 5 17:54:02 CET 2010


Martin, thanks for the help. You are correct, readAligned can read those reads in when the filter is not there. The chromosome filter I had in my command did the screening which eliminated the reads mapped across the junctions, including those were on the desired chromosome (in my original bigger file), since the "chromosome" field are all "splice_sites-auto.fa". Does ShortRead have a parser to extract the splice junction coordinates from the 2nd entry in my previous email, or I need to write myself, as from the pure readAligned (ie, without "filter") it does not seem to be able to interpret the coordinates correctly. Thanks again.

-Kunbin



-----Original Message-----
From: Martin Morgan [mailto:mtmorgan at fhcrc.org] 
Sent: Friday, November 05, 2010 9:28 AM
To: Kunbin Qu
Cc: 'Bioc-sig-sequencing at r-project.org'
Subject: Re: [Bioc-sig-seq] readAligned for Illumina's export file

On 11/05/2010 08:51 AM, Kunbin Qu wrote:
> Dear all,
> 
> can readAligned() or other function read in the reads mapped across
> the junctions in the "export" file (eg, s_1_export.txt)  from
> Illumina's pipeline? The following is the example of a regular
> mapping entry and a read mapped across two exons. I had a test file
> named s1Test, and when I used the following command, it can only read
> in the first read. Thanks.

It's tricky to know what your file looks like, but this should be parsed
by readAligned.

> x = readAligned("/tmp/kunbin_export.txt", type="SolexaExport")
> x
class: AlignedRead
length: 2 reads; width: 51 cycles
chromosome: chrX.fa
splice_sites-auto.faDHRS7_50_50_chr14.fa_59681484_59685824
position: 108773654 20
strand: + -
alignQuality: NumericQuality
alignData varLabels: run lane ... filtering contig
> sread(x)
  A DNAStringSet instance of length 2
    width seq
[1]    51 NTTTTAAAAACAGAATTTCTGCTCTATAATAACACAGCTAAAGGGAAATAA
[2]    51 NGAACTTTAAGAGTGGTGTGGATGCAGACTCTTCTTATTTTAAAATCTTTA
> quality(x)
class: SFastqQuality
quality:
  A BStringSet instance of length 2
    width seq
[1]    51 BKOJHRQPPO_QQ_____b_b___b_bb_bb__bb__b_b___bbb_b__Q
[2]    51 BKIKKUUTTU_____[[[[[[[[[[_b_____b______QQQ__b___b__

maybe your 'cfilt' filters out 'chromosomes' (which should probably have
been something else, rseq?)

> chromosome(x)
[1] chrX.fa
[2] splice_sites-auto.faDHRS7_50_50_chr14.fa_59681484_59685824
2 Levels: chrX.fa ...

More hints on what 'it can only read the first read' means might help.

Martin


> 
> -Kunbin
> 
> SEQUENCER01     10      1       1       5110    943     0       1
> NTTTTAAAAACAGAATTTCTGCTCTATAATAACACAGCTAAAGGGAAATAA
> BKOJHRQPPO_QQ_____b_b___b_bb_bb__bb__b_b___bbb_b__Q     chrX.fa
> 108773654    F       T50     199
> Y
> 
> SEQUENCER01     10      1       1       2815    941     0       1
> NGAACTTTAAGAGTGGTGTGGATGCAGACTCTTCTTATTTTAAAATCTTTA
> BKIKKUUTTU_____[[[[[[[[[[_b_____b______QQQ__b___b__
> splice_sites-auto.faDHRS7_50_50_chr14.fa_59681484_59685824   20
> R       A50     200                                 Y
> 
> 
> 
> 
>> s1t<-readAligned("./", pattern="s1Test", type="SolexaExport",
>> filter=cfil) sessionInfo()
> R version 2.11.0 (2010-04-22) x86_64-unknown-linux-gnu
> 
> locale: [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C [3]
> LC_TIME=en_US.UTF-8        LC_COLLATE=en_US.UTF-8 [5] LC_MONETARY=C
> LC_MESSAGES=en_US.UTF-8 [7] LC_PAPER=en_US.UTF-8       LC_NAME=C [9]
> LC_ADDRESS=C               LC_TELEPHONE=C [11]
> LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
> 
> attached base packages: [1] stats     graphics  grDevices utils
> datasets  methods   base
> 
> other attached packages: [1] ShortRead_1.6.2     Rsamtools_1.0.1
> lattice_0.19-11 [4] Biostrings_2.16.7   GenomicRanges_1.0.1
> IRanges_1.6.8
> 
> loaded via a namespace (and not attached): [1] Biobase_2.8.0
> grid_2.11.0   hwriter_1.2   tools_2.11.0
>> 
> 
> 
> 
> ______________________________________________________________________
>
> 
The contents of this electronic message, including any attachments, are
intended only for the use of the individual or entity to which they are
addressed and may contain confidential information. If you are not the
intended recipient, you are hereby notified that any use, dissemination,
distribution, or copying of this message or any attachment is strictly
prohibited. If you have received this transmission in error, please send
an e-mail to postmaster at genomichealth.com and delete this message, along
with any attachments, from your computer.
> [[alternative HTML version deleted]]
> 
> _______________________________________________ Bioc-sig-sequencing
> mailing list Bioc-sig-sequencing at r-project.org 
> https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing


-- 
Computational Biology
Fred Hutchinson Cancer Research Center
1100 Fairview Ave. N. PO Box 19024 Seattle, WA 98109

Location: M1-B861
Telephone: 206 667-2793

______________________________________________________________________
The contents of this electronic message, including any attachments, are intended only for the use of the individual or entity to which they are addressed and may contain confidential information. If you are not the intended recipient, you are hereby notified that any use, dissemination, distribution, or copying of this message or any attachment is strictly prohibited. If you have received this transmission in error, please send an e-mail to postmaster at genomichealth.com and delete this message, along with any attachments, from your computer.



More information about the Bioc-sig-sequencing mailing list