[Bioc-sig-seq] trimLRPatterns question

[Harris A. Jaffee]

Allowing 2 errors, the first two letters of Rpattern3 match the last  
two letters of the subject.

Maybe you want max.Rmismatch=2, which is effectively c(rep(-1,11),2),  
or something else to prevent
unintended trimming.

On Oct 9, 2009, at 3:53 PM, joseph wrote:

> Hello
>  In the example below, Rpattern2 (2 mismatches) trims the subject  
> correctly, while Rpattern3 (3 mismatches) which is not supposed to  
> do any trimming, it trims the last 2 nucleotides. Can you explain why?
>
>
>> subject <- DNAStringSet("GCTGGAACCCAGGGTGTTGTACCTGTAGGCACCA")
>> Rpattern2 <- "CTGaAGGCACgA" # 2 mismatches
>> Rpattern3 <- "tTGaAGGCACgA" # 3 mismatches
>> trimLRPatterns(Rpattern = Rpattern2, subject = subject,  
>> max.Rmismatch = rep(2, 12))
>   A DNAStringSet instance of length 1
>     width seq
> [1]    22 GCTGGAACCCAGGGTGTTGTAC
>> trimLRPatterns(Rpattern = Rpattern3, subject = subject,  
>> max.Rmismatch = rep(2, 12))
>   A DNAStringSet instance of length 1
>     width seq
> [1]    32 GCTGGAACCCAGGGTGTTGTACCTGTAGGCAC
>
>
>> sessionInfo()
> R version 2.10.0 alpha (2009-10-01 r49909)
> x86_64-apple-darwin9.8.0
>
> locale:
> [1] en_US.UTF-8/en_US.UTF-8/C/C/en_US.UTF-8/en_US.UTF-8
>
> attached base packages:
> [1] stats     graphics  grDevices utils     datasets  methods   base
>
> other attached packages:
> [1] rtracklayer_1.5.17 RCurl_1.2-0        bitops_1.0-4.1      
> ShortRead_1.3.36
> [5] lattice_0.17-25    BSgenome_1.13.16   Biostrings_2.13.48  
> IRanges_1.3.87
>
> loaded via a namespace (and not attached):
> [1] Biobase_2.5.8 grid_2.10.0   hwriter_1.1   tools_2.10.0  XML_2.6-0
>>
>
>
>
> 	[[alternative HTML version deleted]]
>
> _______________________________________________
> Bioc-sig-sequencing mailing list
> Bioc-sig-sequencing at r-project.org
> https://stat.ethz.ch/mailman/listinfo/bioc-sig-sequencing