[Bioc-sig-seq] Biostrings: problem to access indel-details form pairwiseAlignment()

[Wolfgang Raffelsberger]

Dear list,

previously I've been extracting indel-information from sequences aligned 
by the Biostrings function pairwiseAlignment(), which is probably not 
the best way since the class 'PairwiseAlignedFixedSubject' has evoled & 
changed and  my old code won't work any more. Now trying to use the 
library-provided functions  to access the information/details about 
indels (ie their localization on the pattern and possibly the indel 
sequence ). However, I can't find a function to extract this 
information, that is (to the best of my knowledge) part of the aligned 
object.

## here an example :
library(Biostrings)
ref1 <- DNAString("GGGATACTTCACCAGCTCCCTGGC")   # my pattern
samp1 <- 
DNAStringSet(c("GGGATACTACACCAGCTCCCTGGC","GGGATACTTACACCAGCTCCCTGGC","ATACTTCACCAGCTCCCTG"))  

 # 1st has a mutation, 2nd has an insertion, the 3rd is simply shorter ...

align <- pairwiseAlignment(samp1,ref1)

nindel(align)        # insertion was found properly but I can't see at 
which nt position the indel was found (neither if it's an insertion or 
deletion)
indel(align)         # Error in function (classes, fdef, mtable)   
unable to find an inherited method for function...
insertion(align)     # Error in function (classes, fdef, mtable)   
unable to find an inherited method for function ...
deletion(align)      # neither ...
 ?AlignedXStringSet  # says under 'Accessor methods' that indel() exists ..

## ideally I'd be looking for something like
mismatchTable(align)   # but addressing indels ...


## for completeness :
 > sessionInfo()
R version 2.9.1 (2009-06-26)
i386-pc-mingw32

locale:
LC_COLLATE=French_France.1252;LC_CTYPE=French_France.1252;LC_MONETARY=French_France.1252;LC_NUMERIC=C;LC_TIME=French_France.1252

attached base packages:
[1] stats     graphics  grDevices utils     datasets  methods   base    

other attached packages:
[1] ShortRead_1.2.1   lattice_0.17-25   BSgenome_1.12.3   
Biostrings_2.12.7 IRanges_1.2.3   

loaded via a namespace (and not attached):
[1] Biobase_2.4.1 grid_2.9.1    hwriter_1.1 


Thank's in advance,
Wolfgang Raffelsberger

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Wolfgang Raffelsberger, PhD
Laboratoire de BioInformatique et Génomique Intégratives
CNRS UMR7104, IGBMC,  
1 rue Laurent Fries,  67404 Illkirch  Strasbourg,  France
Tel (+33) 388 65 3300         Fax (+33) 388 65 3276
wolfgang.raffelsberger (at) igbmc.fr